Em formação

Qual é a diferença entre DPY-10, DPY-11 e DPY-13?

Qual é a diferença entre DPY-10, DPY-11 e DPY-13?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Meu TA mencionou essas três mutações de C. elegans desde que começamos a trabalhar com os vermes, mas parece ignorar quais são as diferenças ...


Dpy é uma classe de genes. Normalmente são escritos em letras minúsculas quando se referem a um alelo mutante. O próprio nome Dpy significa dumpy e vem da mudança morfológica que ocorre quando um ou mais genes são mutados: os vermes parecem curtos e gordos, ou atarracados.

Outra grande classe é Unc. Mutações nesses genes causam movimento descoordenado.

Para obter uma descrição dos genes, consulte http://www.wormbase.org


A prolil 4-hidroxilase é necessária para a viabilidade e morfogênese em Caenorhabditis elegans

O genoma de Caenorhabditis elegans possui dois genes, dpy-18 e phy-2, que codificam as subunidades α da enzima prolil 4-hidroxilase. Geramos deleções dentro de cada gene para eliminar a atividade da prolil 4-hidroxilase do animal. o dpy-18 mutante tem uma morfologia corporal aberrante, consistente com um papel da prolil 4-hidroxilase na formação da cutícula do corpo. o phy-2 mutante é do tipo fenotipicamente selvagem. No entanto, o dpy-18 phy-2 duplo mutante não é viável, sugerindo um papel essencial para prolil 4-hidroxilase que normalmente é realizado por qualquer dpy-18 ou phy-2. Os efeitos da dupla mutação foram mimetizados por inibidores de pequenas moléculas de prolil 4-hidroxilase, validando os resultados genéticos e sugerindo que C. elegans pode servir como um sistema modelo para a descoberta de novos inibidores.

O colágeno é a proteína mais abundante em animais. Cada cadeia polipeptídica de colágeno é composta de repetições da sequência: X-Y-Gly, onde X é frequentemente um resíduo de l-prolina e Y é frequentemente um 4 (R) -hidroxi- 1 -prolina (Hyp) resíduo. Essas correntes são enroladas em hélices triplas apertadas, que são organizadas em fibrilas de grande resistência à tração. Os grupos hidroxila dos resíduos Hyp contribuem muito para a estabilidade conformacional do colágeno de hélice tripla (1–3). Os resíduos Hyp não são incorporados ao colágeno pelos ribossomos. Em vez disso, a hidroxilação de resíduos de Pro em fitas de colágeno é catalisada pela enzima prolil 4-hidroxilase (EC 1.14.11.2). A prolil 4-hidroxilase foi melhor caracterizada em vertebrados, incluindo humanos (4–7). A enzima de vertebrados é um tetrâmero, composto por duas subunidades α e duas subunidades β. A subunidade α se liga a um cátion divalente Fe 2+, α-cetoglutarato e ascorbato, e possui o sítio ativo para hidroxilação. A subunidade β não é apenas um componente essencial da prolil 4-hidroxilase tetramérica, mas também tem atividade enzimática própria como proteína dissulfeto isomerase (EC 5.3.4.1), uma enzima que catalisa o desembaralhamento de ligações dissulfeto não nativas (8-10 ) Uma deficiência na atividade da prolil 4-hidroxilase é observada em animais que carecem de vitamina C na dieta e tem consequências graves, resultando na doença conhecida como escorbuto (11).

Começamos a investigar o papel biológico da prolil 4-hidroxilase em Caenorhabditis elegans. Este pequeno nematóide fornece várias vantagens experimentais importantes para na Vivo estudos: genética avançada e reversa sofisticada (12, 13), uma morfologia corporal simples que pode ser analisada no nível de células individuais (14) e uma sequência genômica virtualmente completa (15). O colágeno é o principal componente de C. elegans, compreendendo aproximadamente 1% do peso de um nematóide adulto (16). Maioria C. elegans o colágeno está na cutícula e nas membranas basais (17).

Uma subunidade de prolil 4-hidroxilase α e duas subunidades β potenciais foram identificadas no C. elegans genoma e caracterizado bioquimicamente (18, 19). o C. elegans As subunidades α e β são ambas homólogas às suas contrapartes de vertebrados. No entanto, em contraste com a enzima tetramérica de vertebrados, o C. elegans subunidade α formou um dímero αβ com o C. elegans subunidade β ou a subunidade β humana (proteína dissulfeto isomerase). Como a prolil 4-hidroxilase de vertebrado, o C. elegans a enzima interagiu com o cátion divalente Fe 2+, α-cetoglutarato e ascorbato, os cofatores prolil 4-hidroxilase, e também possuía atividade prolil 4-hidroxilase (18, 19).

Aqui, relatamos que o C. elegans O genoma possui dois genes que codificam as subunidades α da prolil 4-hidroxilase. Geramos um mutante de deleção de cada gene e exploramos seus papéis biológicos. Um gene, dpy-18, é essencial para a morfologia do corpo de tipo selvagem, o outro, phy-2, é necessário para dpy-18 viabilidade mutante e vice-versa. Também mostramos que inibidores de moléculas pequenas conhecidas de prolil 4-hidroxilase podem imitar a perda de dpy-18 e phy-2 atividades genéticas.


Resumo

A fenotipagem comportamental de organismos modelo é amplamente utilizada para investigar aspectos fundamentais da biologia do organismo, desde o funcionamento do sistema nervoso até os efeitos de mutações genéticas, bem como para a triagem de novos compostos de drogas. No entanto, nossa capacidade de observar e quantificar toda a gama e complexidade das respostas comportamentais é limitada pela incapacidade das técnicas convencionais de microscopia de capturar informações volumétricas da imagem em velocidade suficiente. Neste artigo, descrevemos como a combinação de microscopia de campo de luz com estimativa de profundidade computacional fornece um novo método para avaliação rápida e quantitativa da postura e movimento 3D do organismo modelo Caenorhabditis elegans (C. Elegans) Nós aplicamos essa técnica para comparar o comportamento de mutantes de colágeno da cutícula, encontrando diferenças significativas na postura e locomoção 3D. Demonstramos a capacidade da microscopia de campo de luz quantitativa para fornecer novos insights fundamentais sobre C. Elegans locomoção analisando os modos posturais 3D de um verme nadando livremente. Finalmente, consideramos os méritos relativos do método e sua aplicação mais ampla para imagens fenotípicas de outros organismos e para outras aplicações de bioimagem volumétrica.

Citação: Shaw M, Zhan H, Elmi M, Pawar V, Essmann C, Srinivasan MA (2018) Fenotipagem comportamental tridimensional de movimento livre C. Elegans usando microscopia de campo de luz quantitativa. PLoS ONE 13 (7): e0200108. https://doi.org/10.1371/journal.pone.0200108

Editor: Giorgio F. Gilestro, Imperial College London, REINO UNIDO

Recebido: 17 de janeiro de 2018 Aceitaram: 19 de junho de 2018 Publicados: 11 de julho de 2018

Direito autoral: © 2018 Shaw et al. Este é um artigo de acesso aberto distribuído sob os termos da Licença de Atribuição Creative Commons, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o autor original e a fonte sejam creditados.

Disponibilidade de dados: Os dados subjacentes a este estudo foram carregados para figshare e estão acessíveis usando o seguinte DOI: 10.6084 / m9.figshare.6670805.

Financiamento: Este trabalho foi financiado por uma Bolsa Avançada 247401 para MAS do Conselho Europeu de Pesquisa (ERC-2009-AdG, MicroNanoTeleHaptics), e uma bolsa Capital para Grandes Tecnologias (EP / K005030 / 1 para MAS) da Engenharia e Ciências Físicas do Reino Unido Conselho de Pesquisa. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do manuscrito.

Interesses competitivos: Os autores declararam que não existem interesses conflitantes.


MATERIAIS E MÉTODOS

Tudo C. elegans as cepas mutantes foram derivadas da cepa N2 Bristol de tipo selvagem e continham um ou mais dos seguintes alelos: rol-6 (su1006) II, lin-8 (n111) II, lin-9 (n112) III, spe-48 (hc85) I (anteriormente identificado como spe-8), spe-10 (hc104) V, dpy-11 (e224) V, unc-76 (e911) V. Cepa havaiana isolada CB4856 (Hodgkin & amp Doniach, 1997) foi usada para mapeamento de polimorfismo. Edição de genes mediada por CRISPR para criar spe-48 (gd11) foi realizado conforme descrito anteriormente (Paix et al., 2015), usando dpy-10 como um marcador co-CRISPR (Arribere et al., 2014). Os reagentes CRISPR estão listados na Tabela Suplemento S1. Os vermes foram propagados usando condições de crescimento padrão (Brenner, 1974). Os ensaios de fertilidade foram realizados conforme descrito anteriormente (Kulkarni et al., 2012).

Bibliotecas de sequenciamento foram construídas usando o kit de preparação de amostra de DNA TruSeq v2 para grandes amostras de entrada ou o kit de preparação de amostra TruSeq ChIP para amostras de baixa entrada (Illumina, San Diego, CA). Resumidamente, as amostras de gDNA foram cortadas por sonicação, reparadas nas extremidades, com cauda A, ligadas por adaptador e amplificadas por PCR. Um protocolo detalhado para a obtenção de gDNA fragmentado de amostras de baixa entrada pode ser encontrado no Suplemento (Arquivo S1). As bibliotecas foram sequenciadas em um HiSeq 2500 (Illumina, San Diego, CA) para gerar leituras de 50 pb e produziram uma cobertura de genoma de & gt20 vezes por amostra. A versão do genoma WS220 (www.wormbase.org) foi usada como referência. Os dados SNP na Figura 1 foram determinados com um pipeline de BFAST (Homer et al., 2009) para alinhamento e SAMtools (Li et al., 2009) para chamadas de variantes. Todos os outros dados SNP foram obtidos usando BBMap (Bushnell, 2015) para alinhamento e FreeBayes (Garrison e Marth, 2012) para chamada de variantes. Leituras duplicadas foram removidas após o alinhamento e, a menos que indicado de outra forma, pelo menos três leituras independentes foram necessárias para uma chamada de variante. ANNOVAR (Wang et al., 2010) foi usado para anotação. Para mapeamento de polimorfismo, as frequências SNP com regressões LOESS foram plotadas contra a posição do cromossomo com R (R Core Team, 2015) usando os mesmos parâmetros relatados para CloudMap (Minevich et al., 2012). Os dados de sequência estão disponíveis no Arquivo de leitura de sequência NCBI (número de acesso do BioProject PRJNA305991).


A aplicação da edição do genoma CRISPR-Cas9 em Caenorhabditis elegans

Recomendar Documentos

Manuscrito aceito A aplicação da edição do genoma CRISPR-Cas9 em Caenorhabditis elegans Suhong Xu PII:

Journal of Genetics and Genomics

Data de recebimento: 11 de maio de 2015 Data de revisão:

Data de aceitação: 19 de junho de 2015

Como citar este artigo: Xu, S., The application of CRISPR-Cas9 genome edition in Caenorhabditis elegans, Journal of Genetics and Genomics (2015), doi: 10.1016 / j.jgg.2015.06.005. Este é um arquivo PDF de um manuscrito não editado que foi aceito para publicação. Como um serviço aos nossos clientes, estamos fornecendo esta versão inicial do manuscrito. O manuscrito passará por revisão, composição e revisão da prova resultante antes de ser publicado em sua forma final. Observe que, durante o processo de produção, podem ser descobertos erros que podem afetar o conteúdo, e todas as isenções de responsabilidade legais que se aplicam à revista pertencem.

A aplicação da edição do genoma CRISPR-Cas9 em Caenorhabditis elegans

Divisão de Ciências Biológicas, Seção de Biologia Celular e do Desenvolvimento, Universidade da Califórnia,

San Diego, 9500 Gilman Drive, La Jolla, CA 92093

A correspondência deve ser enviada para: [e-mail & # 160 protegido]

A edição do genoma usando a endonuclease Cas9 de Streptococcus pyogenes demonstrou incomparável

eficácia e facilidade para modificar genomas em uma ampla variedade de organismos. Caenorhabditis elegans é

um dos organismos multicelulares mais convenientes para análise genética e aplicação deste romance

técnica de edição de genoma para este organismo promete revolucionar a análise da função do gene no

futuro. CRISPR-Cas9 foi usado com sucesso para gerar inserções e exclusões imprecisas via não

mecanismos homólogos de junção de extremidades e para criar mutações precisas por reparo dirigido por homologia a partir de

modelos de doadores. Variáveis-chave são os métodos pelos quais a endonuclease Cas9 é entregue e o

eficiência dos RNAs de guia único. A edição mediada por CRISPR-Cas9 parece ser altamente específica em C.

elegans, sem efeitos fora do alvo relatados. Esta revisão resume brevemente o progresso recente no CRISPR-

Edição de genoma baseada em Cas9 em C. elegans, destacando melhorias técnicas na mutagênese e

detecção de mutações e discussão de possíveis aplicações futuras desta técnica.

Palavras-chave: edição de genoma, CRISPR, Cas9, união de extremidade não homóloga (NHEJ), direcionado por homologia

reparo (HDR), mutação somática, C. elegans

Avanços recentes em tecnologias de edição de genoma que permitem a modificação precisa do duplo

DNA em cadeia de um organismo promete abrir oportunidades sem precedentes para a identificação e

caracterização das funções dos genes em processos biológicos. Essas tecnologias valiosas dependem da descoberta

que as células eucarióticas têm mecanismos endógenos para reparar quebras de fita dupla de DNA (DSBs) (Carroll,

2011). Os DSBs direcionados podem ser reparados por meio da junção de extremidade não homóloga sujeita a erros (NHEJ)

via de reparo, que induz pequenas mutações de inserção ou exclusão (indels) que podem resultar em um quadro

mudança em uma região de codificação, ou através da via de reparo dirigido por homologia (HDR), que introduz

mutações pontuais ou inserção / deleção de uma sequência desejada por recombinação homóloga com

modelos de DNA fornecidos exogenamente. Métodos recentes de edição de genoma também usam nucleases programáveis

para introduzir a interrupção do gene, inserção ou substituição de sequências genômicas de uma maneira controlada

(Segal e Meckler, 2013 Maggio e Goncalves, 2015). Várias endonucleases personalizadas foram

usado na edição de genoma na última década, como meganucleases, nucleases de dedo de zinco (ZFNs) e

nucleases efetoras semelhantes a ativadores de transcrição (TALENs) (Hsu et al., 2014 Maggio e Goncalves, 2015).

Eles estão permitindo manipulações específicas do genoma por meio da interação proteína-DNA para direcionamento. Tudo

essas abordagens forneceram informações valiosas sobre a edição do genoma, no entanto, cada uma tem

fraquezas que limitaram sua aplicação mais ampla.

A abordagem mais recente e em rápido desenvolvimento na edição do genoma é o CRISPR (agrupado regularmente

endonuclease de proteína 9 associada a repetições palindrômicas curtas intercaladas (doravante denominada Cas9),

derivados de sistemas imunológicos adaptativos bacterianos (Doudna e Charpentier, 2014). O CRISPR-Cas9

sistema pode ser usado para atingir virtualmente qualquer locus genômico através de um RNA guia que reconhece o alvo

DNA via emparelhamento de bases Watson-Crick. O sistema CRISPR-Cas9 tipo II de Streptococcus pyogenes é

o mais simples e mais amplamente utilizado, e foi mostrado para introduzir DSBs específicos do site que são

posteriormente reparado por NHEJ ou HDR (Doudna e Charpentier, 2014). Os principais componentes de

o sistema CRISPR-Cas9 é uma endonuclease Cas9 contendo dois domínios de nuclease catalítica (RuvC

e HNH), e uma única quimera de RNA guia (sgRNA) que combina as funções do RNA CRISPR

(crRNA) e crRNA transativador (tracrRNA) (Jinek et al., 2012). O requisito de sequência específica

para a edição cromossômica depende da sequência de 20 nt na extremidade 5 'do sgRNA, que deve ser

seguido por um motivo adjacente de protoespaçador (PAM) de NGG no DNA a fim de clivagem eficiente (Fig.

1). Assim, a edição do genoma mediada por CRISPR-Cas9 é programável e pode ser facilmente direcionada para a maioria

localizações genômicas de escolha através do projeto do sgRNA. Em comparação com outras proteínas guiadas

contrapartes, ZFNs e TALENs, esta ferramenta de edição de genoma guiada por RNA oferece várias vantagens distintas,

como simplicidade, acessibilidade, acessibilidade e multiplexação (Cong et al., 2013 Hsu et al., 2014).

Desde a demonstração histórica da edição do genoma CRISPR-Cas9 em 2012 (Jinek et al., 2012), este

sistema revolucionou a genômica funcional em muitos organismos modelo (Bassett et al., 2013 Belhaj et

al., 2013 Chang et al., 2013 Chen et al., 2013b Cong et al., 2013 DiCarlo et al., 2013 Friedland et al.,

2013 Gratz et al., 2013 Hwang et al., 2013 Li et al., 2013 Mali et al., 2013b Wang et al., 2013b Wei et

al., 2013 Yu et al., 2013 Bassett e Liu, 2014 Ma et al., 2014).

O nematóide Caenorhabditis elegans é um organismo modelo genético amplamente utilizado, no qual

abordagens genéticas reversas têm sido bem desenvolvidas. A edição do genoma baseada em CRISPR-Cas9 foi

aplicado com sucesso a C. elegans e foi revisado recentemente (Frokjaer-Jensen, 2013 Waaijers e

Boxem, 2014). Aqui, eu resumo o rápido desenvolvimento e refinamento recente do CRISPR-Cas9

sistema como uma plataforma para a obtenção de modificações personalizadas do genoma. Eu discuto as melhorias recentes em

Metodologia CRISPR-Cas9 e suas aplicações em C. elegans.

O DESENVOLVIMENTO DE CRISPR-CAS9 EM C. ELEGANS

Embora as mutações de deleção induzidas aleatoriamente sejam prontamente geradas e detectadas por PCR com base

rastreio (Gengyo-Ando e Mitani, 2000 Edgley et al., 2002 Barstead e Moerman, 2006), C.

elegans há muito tempo carece de um sistema genético reverso baseado em homologia eficiente. As primeiras abordagens baseavam-se em

o uso de inserções de transposon (transposons Tc endógenos ou Mos1 exógeno) para criar sites específicos

DSBs (Plasterk e Groenen, 1992 Robert e Bessereau, 2007 Frokjaer-Jensen et al., 2008 Frokjaer-

Jensen et al., 2010 Frokjaer-Jensen et al., 2012). A transposase é capaz de excluir ou inserir o desejado

sequência no local de inserção por meio de HDR. Este método é robusto e permite a edição precisa do genoma,

mas é restrito pela relativa raridade do evento de edição e pela necessidade de um local de inserção do transposon

(Frokjaer-Jensen et al., 2008 Frokjaer-Jensen et al., 2010).

Mais recentemente, as abordagens de edição de genoma baseadas em nuclease (ZFNs e TALENs) também mostraram

trabalho em C. elegans (Wood et al., 2011 Cheng et al., 2013 Lo et al., 2013). Embora tais abordagens

ainda pode ser útil em certas situações, é justo dizer que a eficiência e simplicidade do CRISPR-

O método Cas9 pegou a comunidade C. elegans de assalto, resultando em uma explosão de pesquisas em seu

aplicação e otimização.

Para a edição do genoma mediada por CRISPR-Cas9, um requisito chave é a expressão da proteína Cas9 e

sgRNA no núcleo onde o complexo Cas9-sgRNA-DNA será montado. Expressão da linha germinativa de

Cas9 e sgRNA são necessários para gerar mudanças hereditárias, enquanto a expressão de tecido somático pode gerar

mutações somáticas não hereditárias. Várias implementações de CRISPR-Cas9 foram descritas em C.

elegans, cada um com vantagens e desvantagens (Waaijers e Boxem, 2014). Uma diferença importante

é como Cas9 e sgRNA são entregues ao núcleo da linha germinativa (Fig. 1). Cas9 pode ser entregue por

microinjeção de mRNA transcrito in vitro (Chiu et al., 2013 Katic e Grosshans, 2013), proteína pura

(Cho et al., 2013), ou DNA de plasmídeo (Chen et al., 2013b Dickinson et al., 2013 Friedland et al., 2013 Lo

et al., 2013, Tzur et al., 2013). Da mesma forma, o sgRNA também pode ser introduzido por transcrição in vitro

(Chiu et al., 2013 Cho et al., 2013 Katic e Grosshans, 2013) ou expresso na linha germinativa usando um

Promotor de RNA polimerase III, como U6 (Chen et al., 2013b Dickinson et al., 2013 Friedland et al.,

2013 Tzur et al., 2013) (Tabela 1). Curiosamente, a alimentação bacteriana, que pode fornecer genes duplos específicos

RNAs de fita (dsRNAs), também podem introduzir RNAs guia em vermes que expressam Cas9 para atingir o gene

ruptura (Liu et al., 2014). Esses estudos fundamentais pavimentam o caminho para a implementação generalizada de

Tecnologia CRISPR-Cas9 como ferramenta de edição de genoma em C. elegans. Apesar das diferenças na entrega, todos

das abordagens acima mencionadas tiveram sucesso na geração de mutações. Por causa da facilidade de

clonagem de plasmídeo em comparação com a purificação de proteínas ou RNA, os métodos mais populares atualmente contam com

microinjeção de plasmídeos que expressam a proteína Cas9 e sgRNAs na linha germinativa, seguido por

rastreio de descendência baseado em fenótipo ou baseado em PCR.

A expressão bem-sucedida da proteína Cas9 e sgRNA no núcleo geralmente gera DSBs 3 de extremidades cegas

pares de bases a montante da sequência PAM no cromossomo. Cas9 cliva DNA usando dois catalíticos

domínios: um domínio de nuclease HNH que cliva a fita complementar ao sgRNA, e um RuvC

domínio de nuclease que cliva a fita não complementar (Fig. 1). Ambas as clivagens foram mostradas para

induzir a interrupção do genoma NHEJ sujeito a erros e modificação precisa do genoma baseada em HDR em C. elegans.

Edição imprecisa do genoma por meio de união final não homóloga

Os DSBs de DNA induzidos por nuclease Cas9 podem ser reparados através de NHEJ, resultando na geração eficiente de

pequenas inserções ou exclusões (indels), que podem interromper o quadro de leitura ou região reguladora, portanto

gerar mutações de perda de função (Hsu et al., 2014) (Fig. 1). A expressão da linha germinativa de Cas9 e

sgRNA é essencial para a geração desta mutação hereditária. Em C. elegans, as mutações indel podem ser facilmente

isolados se levarem a fenótipos visíveis, como Unc (locomoção descoordenada) ou Dpy (corpo atarracado

forma). Em experimentos iniciais, a eficiência desta abordagem variou amplamente, variando de 0,5% ―88%

dependendo de diferentes sgRNAs (Tabela 1). Devido à ineficiência da detecção de mutações por PCR, um

método de sgRNA duplo, que usa dois sgRNAs direcionados ao mesmo gene, foi desenvolvido para gerar

Deleções de DNA que potencialmente resultam em mutações nulas moleculares completas (Chen et al., 2014 Xu e

Chisholm, 2014). Na verdade, foi relatado que a abordagem de sgRNA duplo exclui até 24 kb entre

os sgRNAs (Chen et al., 2014).

Edição precisa do genoma via Reparo Direcionado por Homologia

Em comparação com eventos NHEJ, que geram um espectro de mutações na área alvo, o HDR mediado

eventos de reparo usam modelo de DNA que contém homologia de sequência com o local do genoma para gerar

modificações. A edição do genoma dependente de HDR pode ser usada para induzir mutação pontual precisa, adicione

tag de inserção (por exemplo, GFP, FLAG) para o gene cromossômico específico, ou exclua o gene inteiro e substitua-o

com uma construção de expressão de gene (por exemplo, GFP, cassetes de genes de antibióticos) (Fig. 1). Numerosos relatórios têm

foi demonstrado que DSBs induzidos por Cas9 poderiam ser reparados de forma eficiente por HDR em C. elegans (Chen et

al., 2013b Dickinson et al., 2013 Lo et al., 2013 Zhao et al., 2014 Dickinson et al., 2015).

Para HDR bem-sucedido, um modelo de DNA doador também é necessário junto com Cas9 e sgRNA no

núcleo. Existem várias estratégias para fornecer o modelo de doador. A primeira abordagem é usar plasmídeo

Modelos de DNA, que podem ser empregados para projetar uma ampla variedade de alterações de DNA (Dickinson et al.,

2013). No entanto, a clonagem dos braços de homologia necessários em um vetor pode levar tempo. Uma alternativa atraente

é usar oligodesoxinucleotídeos de fita simples (ssODNs), que podem ser sintetizados comercialmente (Zhao et

al., 2014). Curiosamente, fragmentos de DNA gerados por PCR têm sido usados ​​com sucesso como um modelo de doador

(Paix et al., 2014). Um dos problemas potenciais do reparo mediado por HDR é a baixa eficiência (Paix et al.,

2014 Zhao et al., 2014). Embora seja difícil obter estimativas precisas da eficiência do HDR, em geral

a partir desses trabalhos publicados, os mutantes recombinantes foram identificados entre 0,4% -26,3% de F1

animais (Dickinson et al., 2013 Tzur et al., 2013 Paix et al., 2014 Zhao et al., 2014) (Tabela 1).

Curiosamente, a desativação da atividade NHEJ pela inativação do RNAi do gene cku-80, que codifica C.

A proteína de ligação ao DNA de extremidades cegas elegans (KU) pode melhorar significativamente a eficiência de HDR (Ward, 2015).

No entanto, métodos refinados com HDR mais eficientes são de alta prioridade para a comunidade.

Técnicas de nocaute condicional específicas de tecido ou estágio são importantes para determinar o foco do gene

função em organismos multicelulares. Várias estratégias têm sido usadas para gerar mutações condicionais

em C. elegans, incluindo o Cre-LoxP baseado em recombinase específica do local (Flavell et al., 2013) e Flp-FRT

sistemas (Voutev e Hubbard, 2008), ou tecido e RNAi específico de estágio (Hannon, 2002). CRISPR-Cas9

sistema também pode ser usado para gerar mutações somáticas expressando Cas9 em células somáticas sob o

controle de um indutível (por exemplo, promotor de choque térmico, hsp-16) ou específico do tecido (por exemplo, neuronal, epidérmico,

muscular e intestinal) (Liu et al., 2014 Shen et al., 2014). Curiosamente, foi relatado que

A atividade de Cas9 pode ao longo de gerações, uma vez que o transgene somático Cas9 é estabelecido (Shen et al.,

2014), e mais importante, esta mutação somática pode ser resgatada pelo fornecimento da proteína de fusão GFP (Li et al.,

2015). Através da clivagem de DNA direcionada CRISPR-Cas9, esta metodologia permite a investigação de

funções de genes essenciais no desenvolvimento pós-embrionário e fornece a capacidade de dissecar o tecido

papéis específicos de um único gene (Shen et al., 2014 Li et al., 2015 Tian et al., 2015). Esses estudos também

demonstraram que o somático CRISPR-Cas9 é rápido, versátil e econômico em comparação com outros

técnicas de nocaute condicional. No entanto, uma ressalva é que o CRISPR-Cas9 somático introduziu

lesões moleculares são provavelmente heterogêneas e geralmente não são bem caracterizadas no nível de DNA

seqüência ou na distribuição celular. Além disso, como mutação hereditária, a eficiência da mutação somática

parece ser altamente variável entre genes de 10% a 90% (Shen et al., 2014 Li et al., 2015), que

pode depender do projeto do sgRNA. Resultados negativos ou parciais com abordagens de mutagênese específica de tecido

deve ser tratada com cautela no momento.

Apesar do poder e versatilidade do sistema CRISPR-Cas9, uma preocupação séria é o potencial de desligamento

clivagem alvo e mutagênese. CRISPR-Cas9 parece causar níveis relativamente altos de fora do alvo

mutações em linhas celulares humanas (Fu et al., 2013 Hsu et al., 2013). No entanto, curiosamente, foi

demonstraram que a mutagênese induzida por Cas9 é altamente específica em ambos os embriões de camundongo (Wang et al.,

2013a Yang et al., 2013) e células iPS humanas (Smith et al., 2014 Veres et al., 2014). Além disso, todo

o sequenciamento do genoma e o exame de loci fora do alvo selecionados ainda não encontraram quaisquer efeitos fora do alvo em C.

elegans (Waaijers e Boxem, 2014). A mutagênese fora do alvo pode ser menos problemática nas células normais

(Singh et al., 2015), bem como genoma de C. elegans menor e menos redundante. Apesar do baixo risco de

fora do alvo, o fenótipo de mutante gerado pelo sistema CRISPR-Cas9 deve ser analisado com cuidado,

e esta especificidade de alvo pode ser determinada seguindo as regras gerais, como retrocruzamento, independente

alelos gerados por meio de múltiplos sgRNAs e resgate de mutação sinônimo (Waaijers e Boxem, 2014

Li et al., 2015 Tian et al., 2015).

EFICIÊNCIA AUMENTADA DA EDIÇÃO DO GENOMA MEDIADO CRISPR-CAS9

Apesar de vários relatos de mutagênese altamente eficiente, tornou-se claro que a eficiência de

O direcionamento de CRISPR-Cas9 pode variar amplamente, de gene para gene e entre diferentes sgRNAs. Muito esforço

está sendo aplicado para discernir as causas dessa variação e para aumentar a eficiência da reação. Desde Cas9

a clivagem de DNA direcionada requer apenas dois componentes (Cas9 e o sgRNA), estratégias para melhorar

a eficiência tem se concentrado em aumentar a atividade de Cas9 e a atividade de ligação de sgRNA.

Cas9 gera DSBs de extremidade cega perto da sequência PAM em um processo mediado por duas nucleases

domínios: HNH e RuvC, que clivam a fita de DNA complementar e não complementar ao

sgRNA, respectivamente. Mutações de qualquer um dos dois domínios de nuclease (H840A em HNH e D10A em

RuvC) resulta em uma atividade de nickase de Cas9 (Cong et al., 2013 Jinek et al., 2012 Mali et al., 2013c), que

cria uma quebra de fita simples (SSB) que pode ser reparada por meio do reparo de excisão de base de alta fidelidade (BER)

caminho (Dianov e Hubscher, 2013). Vários estudos em mamíferos e Drosophila relataram que

uma abordagem de corte duplo melhora significativamente a especificidade de DSBs no destino por meio de corte de deslocamento

(Mali et al., 2013a Ran et al., 2013 Port et al., 2014). Além disso, na presença de um modelo de doador,

O DNA clivado por essas nickases é preferencialmente reparado por HDR em vez de por NHEJ. Consequentemente,

o uso dessas nickases Cas9 aumentou significativamente a eficiência de HDR em detrimento de NHEJ (Cong et

al., 2013 Mali et al., 2013c) em comparação com o Cas9 de tipo selvagem. Até o momento, o uso de nickase Cas9 não foi

relatado em C. elegans. Seria muito interessante explorar se as nickases Cas9 podem aumentar o

eficiência de direcionamento através do HDR em C. elegans. O nível de expressão de Cas9 também afeta a frequência de

geração mutante. Um estudo inicial de C. elegans demonstrou alta concentração de expressão de Cas9

plasmídeo em injeção aumenta significativamente as mutações alvo (Friedland et al., 2013). Assim, a injeção de

mRNA sintetizado in vitro ou proteína pode aumentar a frequência de mutagênese alvo devido ao

dose mais elevada de Cas9 no núcleo da linha germinativa em comparação com a alcançada após a injeção de uma codificação Cas9

plasmídeo (Tabela 1) (Chiu et al., 2013 Cho et al., 2013 Katic e Grosshans, 2013).

O outro componente importante e crítico do sistema CRISPR-Cas9 é o RNA guia único, que

encontrar e ligar aos loci do genoma alvo. O aumento da atividade de ligação do sgRNA pode aumentar o

Eficiência de clivagem de DNA baseada em CRISPR. Progresso recente em mamíferos e C. elegans

experimentos demonstraram que um sgRNA modificado (E + F) (E, extensão de grampo de cabelo F, A-U flip), contendo

uma estrutura em gancho de ligação de Cas9 estendida e excluída para um terminador Pol III putativo (4

U′s) no stem-loop de sgRNA por uma inversão de par de bases A-U, exibe atividade melhorada (Chen et al., 2013a

Ward, 2015). Outra descoberta provocativa em C. elegans é que os RNAs de guia com um motivo GG na extremidade 3′

das sequências específicas do alvo podem aumentar drasticamente a frequência de mutagênese via NHEJ

e HDR (Farboud e Meyer, 2015). Combinar essas duas estratégias para o projeto de sgRNA pode ainda mais

aumentar a frequência de mutagênese.

IDENTIFICAÇÃO DE MUTAÇÃO ATRAVÉS DA SELEÇÃO EFICIENTE

Mesmo que a mutagênese CRISPR-Cas9 possa ser altamente eficiente, é igualmente importante minimizar a

tempo e trabalho despendidos em encontrar os animais mutantes. A edição do genoma mediada por CRISPR-Cas9 pode ser

identificados por técnicas moleculares básicas, como amplificação por PCR do local em torno dos DSBs.

Os amplicons de PCR da progênie F1 (e marcadores positivos de co-injeção) de vermes podem então ser analisados ​​usando um

endonuclease que reconhece especificamente DNA incompatível, como a endonuclease I de T7 ou CEL I. É

também relativamente fácil de identificar heterozigotos para deleções geradas por nocaute dirigido por sgRNA duplo

(Chen et al., 2014 Xu e Chisholm, 2014). Ao adicionar um local de restrição ao modelo do doador, HDR

a modificação genômica baseada pode ser mais facilmente identificada por PCR seguida por digestão enzimática

(Dickinson et al., 2013 Paix et al., 2014). A mutação precisa pode então ser buscada por sequenciamento de DNA.

É importante notar que qualquer mutante identificado na PCR deve ser confirmado nas gerações subsequentes para

evitar falsos positivos devido a mutações somáticas (Cho et al., 2013). Nos casos em que a eficiência da mutagênese é

baixo, a triagem de PCR de mutantes F1 pode ser trabalhosa. Foi recentemente demonstrado que a detecção de

mutantes direcionados poderiam se beneficiar do refinamento com a combinação da genética de C. elegans. Diversos

métodos promissores foram estabelecidos para explorar fenótipos visíveis, resistência ao tratamento com drogas ou

seleções de marcadores, minimizando o trabalho prático, o tempo e o dinheiro gasto na triagem PCR

Seleção de fenótipo visível

Os relatórios iniciais de edição de genoma mediada por CRISPR-Cas9 em C. elegans testaram genes cuja perda de

função era bem conhecida por conferir fenótipos pós-embrionários recessivos visíveis, como Unc ou Dpy.

Mutações recentemente induzidas podem ser simplesmente identificadas pelo isolamento de animais transgênicos F1 (putativos

heterozigotos) e examinando sua progênie F2 para o fenótipo esperado (Friedland et al., 2013).

Vários outros artigos descrevem estratégias semelhantes para isolar mutantes gerados por CRISPR (Chiu et al., 2013

Cho et al., 2013). Insertion mutations could in principle also be isolated by rescue of a visible phenotype

such as Unc (Dickinson et al., 2013), as successfully used in MosSCI mediated genome editing (Frokjaer-

Jensen et al., 2008 Dickinson et al., 2013). Thus, visible phenotype selection, if applicable, provides a

simple and powerful way to detect desired mutations.

Selection for antibiotic- or drug-resistance is a powerful means to find dominant resistant mutants.

Initially, several groups tested the efficiency of CRISPR-Cas9 targeted gene mutation using ben-1

(benomyl resistance-1) (Chen et al., 2013b Katic and Grosshans, 2013), encoding a tubulin whose loss-

of-function confers dominant resistance to benomyl. Comparable selections can also be used to identify

HDR events and simplify the screen strategy. Several exogenous antibiotic gene cassettes have been used

in C. elegans, such as neomycin, puromycin, hygromycin B and blasticidin. Selection and

counterselection strategies using HygR (hygromycin B-resistance gene) or BSD (blasticidin-resistance

gene) have been successfully applied to select animals with a transgene inserted by Cas9 via HDR (Chen

et al., 2013b Kim et al., 2014). In cases where HygR/BSD expression may disrupt the function of the

modified gene, the antibiotic gene cassette can be flanked with LoxP sites and removed by expression of

Cre recombinase. The delivery of Cre can be achieved either by subsequent microinjection of plasmid

(Dickinson et al., 2013), or by a heat-shock inducible promoter embedded in a self-excising drug selection

cassette (SEC) that was developed recently (Dickinson et al., 2015).

Fluorescence marker selection

C. elegans is effectively transparent, allowing fluorescence imaging in live animals and providing another

efficient positive selection strategy. Insertion of green fluorescent protein (GFP) to the CRISPR-Cas9

targeted site allows mutated animals to be identified by suitable fluorescence microcopy (Dickinson et al.,

2013 Tzur et al., 2013 Waaijers et al., 2013). Generated mutants in any fluorescence marker background

and identified morphology defects based on the fluorescence signal may provide another efficient way to

isolate the mutants. This simple selection strategy by visible fluorescent marker could significantly reduce

the hands-on screening work.

A hallmark of the natural CRISPR-Cas9 system is its ability to cleave multiple distinct targets

simultaneously and efficiently (Cong et al., 2013) within a single nucleus, the Cas9 protein can be

targeted to multiple genomic loci directed by different sgRNAs. Thus, use of a previously proven sgRNA

that results in an easily recognized visible phenotype may allow to identification of progeny of an animal

in which Cas9 was active. The validity of such multiplexing approaches is supported by the success of co-

CRISPR strategies, in which selection of animals with CRISPR-Cas9 induced NHEJ mutations at the unc-

22 locus enriched for CRISPR-Cas9 induced NHEJ events at a second unlinked locus (Kim et al., 2014).

This elegant co-CRISPR strategy not only significantly improved the frequency of detecting NHEJ events

(30%―80%), but also facilitated recovery of HDR events (10%―50%) (Kim et al., 2014). Such co-

CRISPR strategies should be very valuable in increasing efficiency in the generation of desired mutations,

and potentially without the necessity of extensive screening, or counter-selection.

Similar to co-CRISPR, in which CRISPR-Cas9 induced NHEJ mutation at the unc-22 locus increase the

efficient recovery of other NHEJ events (Kim et al., 2014), a co-conversion strategy was also invented to

efficiently recover HDR events in any gene in an otherwise unmarked genetic background (Arribere et al.,

2014). This strategy is also based on the idea that multiplex CRISPR of a marker gene, where HDR yields

an easily discernable phenotype, should enable identification of animals with the desired (unmarked)

mutation event, since such animals must have descended from a parental germline containing active Cas9,

guide RNA and donor DNA templates. Dominant mutations in morphological cuticle collagen genes such

as dpy-10(cn64), sqt-1(e1350) and rol-6(su1006) were induced and used to screen the F1 animals

(Arribere et al., 2014). In addition, rescue of a temperature sensitive lethal mutant pha-1(e2123) has also

been used as an alternate co-conversion selection marker for HDR events (Ward, 2015). In contrast to co-

conversion of dominant mutations, which does not depend on a specific genetic background, the pha-1(ts)

approach has to start with a mutant animal and results in restoration of a wild-type phenotype (Ward,

2015). These co-conversion methods significantly improved the efficiency up to 80% (Arribere et al.,

2014 Ward, 2015). The successes of these distinct variations of co-editing selection highlight the

robustness of CRISPR-Cas9 genome editing methods to detect the desired mutant. With this, it is

potential that any mutation of a gene could be made without any constraints on the genetic background,

minimizing the hands-on screening.

DESIGN CONSIDERATION AND IMPLMENTATION

It is less than two years since CRISPR-Cas9 was first reported in C. elegans, and the state of the art is in

rapid flux. Many variables and strategies have been tested in many laboratories, making it hard at times to

fairly compare the different approaches. However, some general considerations and advice can be put

forward. Based on the selection schemes summarized above, we can now design different approaches to

generate desired knock-ins and knock-outs, and some potential strategies are summarized in Table 3.

These approaches combine the advantages of current optimized selection methods. The main purpose of

all these strategies is: (1) to increase specificity and efficiency of mutagenesis, and (2) to minimize the

time and the hands-on labor needed to detect and recover mutants. As yet, no method can be absolutely

guaranteed to generate the desired mutation. Possibly the most important advice is that several different

sgRNAs should be tested using SUREYOR assay to compare the efficiency of the DNA cleavage, since

for any given gene or site a significant fraction of sgRNAs tested fail to induce any events (Arribere et al.,

2014 Kim et al., 2014). The basis of this variable effectiveness of sgRNAs remains unclear. The coupling

of optimized sgRNA design [3′ GG-guide RNA and sgRNA(E+F)] with co-CRISPR, co-conversion, or

recently designed SEC strategies may together strongly enhance mutagenesis and facilitate mutant

recovery (Dickinson et al., 2015 Farboud and Meyer, 2015).

The advent of CRISPR-Cas9 represents an effective next-generation method for programmable genome

editing, which will have significant impacts on future advancements in genetic manipulations in C.

elegans. It will change the way that we think of and perform the genetic and genomic analysis. Combined

with the power of C. elegans forward genetics, existing genetic mutants and powerful developmental

genetic tools that already available, the tractability of CRISPR-Cas9 offers researchers a versatile genome

editing tool to modify genes of interest. The CRISPR-Cas9 system is rapidly evolving, and fresh

developments are reported monthly. However, some applications of CRISPR-Cas9 have not been reported

in C. elegans. For example, catalytically inactive Cas9 fusion proteins can be targeted to specific DNA

loci to regulate gene transcription in other systems (Gilbert et al., 2013 Larson et al., 2013 Qi et al., 2013

Ji et al., 2014 Choudhary et al., 2015), but this inactive Cas9 regulated transcription has not been

described yet in C. elegans. CRISPR-Cas9 technology should also dramatically facilitate the use in other

nematodes lacking well-developed genetics, including species distantly related to C. elegans or parasitic

nematodes. A further application is to organelle inheritance. Mitochondria contain their own mtDNA

genomes and mitochondrial genetics is drastically different from the Mendelian genetics of nuclear genes.

mtDNA is present in multiple copies in different stage in C. elegans, ranging from

embryo and first three larvae stage to 780,000 copies in the adult stage (Lemire, 2005). Recently,

mitochondrial DNA has been mutated by mitochondrial-targeted TALENs (Bacman et al., 2013

Gammage et al., 2014 Reddy et al., 2015), suggesting potential ways to edit the mitochondrial genome.

Mitochondrial genome editing by Cas9 has not so far been reported, but may be another avenue for

CRISPR-Cas9 mediated targeted DNA editing not only in C. elegans but also in other systems. Indeed,

CRISPR-Cas9 significantly reduces the technological barrier for reverse genetics in any organism,

opening up a much wider arena for the genetic dissection of cellular processes.

I thank Dr. Andrew Chisholm for his critical reading and comments on this manuscript. I thank

Guangshuo Ou, Kyung Won Kim, Zhiping Wang and members of the Jin and Chisholm labs for

comments on the manuscript. S.X is an assistant project scientist in the Chisholm lab at the University of

California, San Diego. The work in the Dr. Andrew Chisholm’s lab is supported by National Institutes of

Health (NIH) grant R01 GM054657 to A.D.C.

Fig. 1. Diagram of CRISPR-Cas9 genome editing methodology in C. elegans.

Cas9 (dodger blue) and guided RNA (green) can be expressed in C. elegans germline by microinjecting

the mixture of plasmids, mRNA or combination of Cas9 protein and sgRNA mRNA. Successfully

expressed Cas9 and sgRNA will be assembled as a complex at its dsDNA target site. Two nuclease

domains RuvC and HNH cleave the DNA close to 5′ end of the PAM (yellow) sequence and generate

double-strand breaks (DSBs), which typically repaired by error-prone non-homologous end-joining

(NHEJ) or homology-directed repair (HDR). NHEJ can lead to the introduction of insertion/deletion

mutations (indels) (purple) of various lengths, which therefore disrupt gene function. HDR-mediated

repair can introduce specific point mutation or insert/delete desired sequences (red) through

recombination of the target locus with provided exogenous donor templates.

Arribere, J.A., Bell, R.T., Fu, B.X., Artiles, K.L., Hartman, P.S., Fire, A.Z., 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198, 837-846.

Bacman, S.R., Williams, S.L., Pinto, M., Peralta, S., Moraes, C.T., 2013. Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat. Med. 19, 1111-1113.

Barstead, R.J., Moerman, D.G., 2006. C. elegans deletion mutant screening. Methods Mol. Biol. 351, 5158.

Bassett, A.R., Tibbit, C., Ponting, C.P., Liu, J.L., 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4, 220-228.

Bassett, A.R., Liu, J.L., 2014. CRISPR/Cas9 and genome editing in Drosophila. J. Genet. Genomics 41, 7-19.

Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V., 2013. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 9, 39.

Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188, 773-782.

Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., Xi, J.J., 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465-472.

Chen, B., Gilbert, L.A., Cimini, B.A., Schnitzbauer, J., Zhang, W., Li, G.W., Park, J., Blackburn, E.H., Weissman, J.S., Qi, L.S., Huang, B., 2013a. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491.

Chen, C., Fenk, L.A., de Bono, M., 2013b. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 41, e193.

Chen, X., Xu, F., Zhu, C., Ji, J., Zhou, X., Feng, X., Guang, S., 2014. Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Sci. Rep. 4, 7581.

Cheng, Z., Yi, P., Wang, X., Chai, Y., Feng, G., Yang, Y., Liang, X., Zhu, Z., Li, W., Ou, G., 2013. Conditional targeted genome editing using somatically expressed TALENs in C. elegans. Nat. Biotechnol. 31, 934-937.

Chiu, H., Schwartz, H.T., Antoshechkin, I., Sternberg, P.W., 2013. Transgene-free genome editing in Caenorhabditis elegans using CRISPR-Cas. Genetics 195, 1167-1171.

Cho, S.W., Lee, J., Carroll, D., Kim, J.S., 2013. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195, 1177-1180.

Choudhary, E., Thakur, P., Pareek, M., Agarwal, N., 2015. Gene silencing by CRISPR interference in mycobacteria. Nat. Commun. 6, 6267.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.

Dianov, G.L., Hubscher, U., 2013. Mammalian base excision repair: the forgotten archangel. Nucleic Acids Res. 41, 3483-3490.

DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J., Church, G.M., 2013. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336-4343.

Dickinson, D.J., Ward, J.D., Reiner, D.J., Goldstein, B., 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat. Methods 10, 1028-1034.

Dickinson, D.J., Pani, A.M., Heppert, J.K., Higgins, C.D., Goldstein, B., 2015. Streamlined genome engineering with a self-excising drug selection cassette. Genetics doi:10.1534/genetics.115.178335

Doudna, J.A., Charpentier, E., 2014. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096.

Edgley, M., D'Souza, A., Moulder, G., McKay, S., Shen, B., Gilchrist, E., Moerman, D., Barstead, R., 2002. Improved detection of small deletions in complex pools of DNA. Nucleic Acids Res. 30, e52.

Farboud, B., Meyer, B.J., 2015. Dramatic enhancement of genome editing by CRISPR/Cas9 through improved guide RNA design. Genetics 199, 959-971.

Flavell, S.W., Pokala, N., Macosko, E.Z., Albrecht, D.R., Larsch, J., Bargmann, C.I., 2013. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell 154, 1023-1035.

Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., Calarco, J.A., 2013. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat. Methods 10, 741-743.

Frokjaer-Jensen, C., 2013. Exciting prospects for precise engineering of Caenorhabditis elegans genomes with CRISPR/Cas9. Genetics 195, 635-642.

Frokjaer-Jensen, C., Davis, M.W., Ailion, M., Jorgensen, E.M., 2012. Improved Mos1-mediated transgenesis in C. elegans. Nat. Methods 9, 117-118.

Frokjaer-Jensen, C., Davis, M.W., Hollopeter, G., Taylor, J., Harris, T.W., Nix, P., Lofgren, R., Prestgard-Duke, M., Bastiani, M., Moerman, D.G., Jorgensen, E.M., 2010. Targeted gene deletions in C. elegans using transposon excision. Nat. Methods 7, 451-453.

Frokjaer-Jensen, C., Davis, M.W., Hopkins, C.E., Newman, B.J., Thummel, J.M., Olesen, S.P., Grunnet, M., Jorgensen, E.M., 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nat. Genet. 40, 1375-1383.

Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., Sander, J.D., 2013. Highfrequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 31, 822-826.

Gammage, P.A., Rorbach, J., Vincent, A.I., Rebar, E.J., Minczuk, M., 2014. Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations. EMBO Mol. Med. 6, 458-466.

Gengyo-Ando, K., Mitani, S., 2000. Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 269, 64-69.

Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451.

Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M., Wildonger, J., O'Connor-Giles, K.M., 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029-1035.

Hannon, G.J., 2002. RNA interference. Nature 418, 244-251.

Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278.

Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., Zhang, F., 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827-832.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K., Peterson, R.T., Yeh, J.R., 2013. Heritable and precise zebrafish genome editing using a CRISPR-Cas system. PLoS One 8, e68708.

Ji, W., Lee, D., Wong, E., Dadlani, P., Dinh, D., Huang, V., Kearns, K., Teng, S., Chen, S., Haliburton, J., Heimberg, G., Heineike, B., Ramasubramanian, A., Stevens, T., Helmke, K.J., Zepeda, V., Qi, L.S., Lim, W.A., 2014. Specific gene repression by CRISPRi system transferred through bacterial conjugation. ACS Synth. Biol. 3, 929-931.

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.

Katic, I., Grosshans, H., 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195, 1173-1176.

Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte, D., Jr., Shirayama, M., Mello, C.C., 2014. A coCRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197, 1069-1080.

Larson, M.H., Gilbert, L.A., Wang, X., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat. Protoc. 8, 2180-2196.

Lemire, B., 2005. Mitochondrial genetics. WormBook, 1-10.

Li, W., Teng, F., Li, T., Zhou, Q., 2013. Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat. Biotechnol. 31, 684-686.

Li, W., Yi, P., Ou, G., 2015. Somatic CRISPR-Cas9-induced mutations reveal roles of embryonically essential dynein chains in Caenorhabditis elegans cilia. J. Cell Biol. 208, 683-692.

Liu, P., Long, L., Xiong, K., Yu, B., Chang, N., Xiong, J.W., Zhu, Z., Liu, D., 2014. Heritable/conditional genome editing in C. elegans using a CRISPR-Cas9 feeding system. Cell Res. 24, 886-889.

Lo, T.W., Pickle, C.S., Lin, S., Ralston, E.J., Gurling, M., Schartner, C.M., Bian, Q., Doudna, J.A., Meyer, B.J., 2013. Precise and heritable genome editing in evolutionarily diverse nematodes using TALENs and CRISPR/Cas9 to engineer insertions and deletions. Genetics 195, 331-348.

Ma, Y., Zhang, X., Shen, B., Lu, Y., Chen, W., Ma, J., Bai, L., Huang, X., Zhang, L., 2014. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. 24, 122-125.

Maggio, I., Goncalves, M.A., 2015. Genome editing at the crossroads of delivery, specificity, and fidelity. Trends Biotechnol. 33, 280-291.

Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., Church, G.M., 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31, 833-838.

Mali, P., Esvelt, K.M., Church, G.M., 2013b. Cas9 as a versatile tool for engineering biology. Nat. Methods 10, 957-963.

Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013c. RNA-guided human genome engineering via Cas9. Science 339, 823-826.

Paix, A., Wang, Y., Smith, H.E., Lee, C.Y., Calidas, D., Lu, T., Smith, J., Schmidt, H., Krause, M.W., Seydoux, G., 2014. Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 198, 1347-1356.

Plasterk, R.H., Groenen, J.T., 1992. Targeted alterations of the Caenorhabditis elegans genome by transgene instructed DNA double strand break repair following Tc1 excision. Embo J. 11, 287-290.

Port, F., Chen, H.M., Lee, T., Bullock, S.L., 2014. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc. Natl. Acad. Sci. USA 111, E2967-2976.

Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., Lim, W.A., 2013. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183.

Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., Zhang, F., 2013. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389.

Reddy, P., Ocampo, A., Suzuki, K., Luo, J., Bacman, S.R., Williams, S.L., Sugawara, A., Okamura, D., Tsunekawa, Y., Wu, J., Lam, D., Xiong, X., Montserrat, N., Esteban, C.R., Liu, G.H., Sancho-Martinez, I., Manau, D., Civico, S., Cardellach, F., Del Mar O'Callaghan, M., Campistol, J., Zhao, H., Campistol, J.M., Moraes, C.T., Izpisua Belmonte, J.C., 2015. Selective elimination of mitochondrial mutations in the germline by genome editing. Cell 161, 459-469.

Robert, V., Bessereau, J.L., 2007. Targeted engineering of the Caenorhabditis elegans genome following Mos1-triggered chromosomal breaks. Embo J. 26, 170-183.

Segal, D.J., Meckler, J.F., 2013. Genome engineering at the dawn of the golden age. Annu. Rev. Genomics Hum. Genet. 14, 135-158.

Shen, Z., Zhang, X., Chai, Y., Zhu, Z., Yi, P., Feng, G., Li, W., Ou, G., 2014. Conditional knockouts generated by engineered CRISPR-Cas9 endonuclease reveal the roles of coronin in C. elegans neural development. Dev. Cell 30, 625-636.

Singh, P., Schimenti, J.C., Bolcun-Filas, E., 2015. A mouse geneticist's practical guide to CRISPR applications. Genetics 199, 1-15.

Smith, C., Gore, A., Yan, W., Abalde-Atristain, L., Li, Z., He, C., Wang, Y., Brodsky, R.A., Zhang, K., Cheng, L., Ye, Z., 2014. Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs. Cell Stem Cell 15, 12-13.

Tian, D., Diao, M., Jiang, Y., Sun, L., Zhang, Y., Chen, Z., Huang, S., Ou, G., 2015. Anillin Regulates Neuronal migration and neurite growth by linking RhoG to the actin cytoskeleton. Curr. Biol. 25, 11351145.

Tzur, Y.B., Friedland, A.E., Nadarajan, S., Church, G.M., Calarco, J.A., Colaiacovo, M.P., 2013. Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system. Genetics 195, 1181-1185.

Veres, A., Gosis, B.S., Ding, Q., Collins, R., Ragavendran, A., Brand, H., Erdin, S., Cowan, C.A., Talkowski, M.E., Musunuru, K., 2014. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15, 27-30.

Voutev, R., Hubbard, E.J., 2008. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. Genetics 180, 103-119.

Waaijers, S., Boxem, M., 2014. Engineering the Caenorhabditis elegans genome with CRISPR/Cas9. Methods 68, 381-388.

Waaijers, S., Portegijs, V., Kerver, J., Lemmens, B.B., Tijsterman, M., van den Heuvel, S., Boxem, M., 2013. CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans. Genetics 195, 1187-1191.

Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., Jaenisch, R., 2013a. Onestep generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918.

Wang, Y., Li, Z., Xu, J., Zeng, B., Ling, L., You, L., Chen, Y., Huang, Y., Tan, A., 2013b. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 23, 1414-1416.

Ward, J.D., 2015. Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair. Genetics 199, 363-377.

Wei, C., Liu, J., Yu, Z., Zhang, B., Gao, G., Jiao, R., 2013. TALEN or Cas9 - rapid, efficient and specific choices for genome modifications. J. Genet. Genomics 40, 281-289.

Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., Meyer, B.J., 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333, 307.

Xu, S., Chisholm, A.D., 2014. C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Dev. Cell 31, 48-60.

Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., Jaenisch, R., 2013. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell 154, 1370-1379.

Yu, Z., Ren, M., Wang, Z., Zhang, B., Rong, Y.S., Jiao, R., Gao, G., 2013. Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195, 289-291.

Zhao, P., Zhang, Z., Ke, H., Yue, Y., Xue, D., 2014. Oligonucleotide-based targeted gene editing in C. elegans via the CRISPR/Cas9 system. Cell Res. 24, 247-250.


Materiais e métodos

C. elegans strains

The Bristol strain N2 was used as the standard wild-type strain. 27 The following mutant alleles were used in this work: unc-46(e177), mdf-1(gk2), dpy-5(s1300), dog-1(gk10), dhc-1(or283ts), dpy-10(e128), dpy-17(e164), dpy-13(e184), unc-119(ed3), ttTi5605, dotSi100, cxTi10882, dotSi110, such-4(h2168) and nT1[let-?(m435)]. The following strains were used in this work: N2 (Bristol strain as a wild-type), KR4233 [unc-46(e177) mdf-1(gk2) such-4(h2168)] KR3627 [unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)])] VC13 [dog-1(gk10)] EU1385 [dhc-1(or283ts)] JNC100 [unc-119(ed3) I dotSi100 II (T06E6.2 + unc-119(+)]] AZ212 [unc-119(ed3) ruIs32[unc-119(+) pie-1∷GFP∷H2B] III] and JNC144 [unc-119(ed3) I dotSi110 IV (T06E6.2 + unc-119(+)]]. Additional strains used in this work were generated in this study. Strains were maintained using standard protocol on nematode growth media (NGM) plates seeded with OP50 bacteria. 27 The strains were maintained at 20°C, while the phenotypic analyses were performed at both 20°C and 25°C as noted in the results section.

Mutation accumulation procedure and phenotypic analysis

The first suppressor, such-4, was isolated as previously described. 9 One clone from this strain, unc-46 mdf-1 such-4 dog-1 was outcrossed from the dog-1(gk10) background to avoid further accumulation of mutations and the KR4233 [mdf-1(gk2) such-4(h2168)] was generated and analyzed. 10,13 The second strain (JNC170) was maintained at 20ºC for 470 generations to allow further accumulation of mutations. Each generation 5 L4 hermaphrodites were transferred to a fresh plate. We also froze the worms at generations 170 (JNC168) and 270 JNC169). Then, at F170, F270 e F470 phenotypic analysis was performed for each strain. Ten L4 hermaphrodites were plated individually and analyzed for number of embryonic arrests, larval arrests, adults and fertile adults, as described previously. 9 In total, 5 to eight trials per strain were performed and SEM (standard error of the mean) was calculated and represented as error bars. Note that mdf-1(gk2) is linked to unc-46(e177) which results in an uncoordinated (Unc) phenotype and allows visual identification of mdf-1(gk2) homozygotes.

Genetic analysis of the unc-46 mdf-1 such-4 dog-1F470 genoma

To map suppressor mutations to a chromosome, we used Dpy (Dumpy) markers located in the central regions of the autosomes. To identify candidate genes in the mapped regions, we combined WGS and oaCGH analyses. Genomic DNA was prepared from JNC168, JNC169 and JNC170 following a standard protocol (http://www.genetics.wustl.edu/tslab/Protocols/genomic_DNA_prep.htm) originally set up by Andy Fire's Laboratory. For the WGS, using Illumina Solexa technology, libraries were prepared and sequenced at Canada's Michael Smith Genome Sciences Center for JNC170 and Simon Fraser University for JNC168 and JNC169. oaCGH analysis was performed as described by Maydan and colleagues 28 using the newly designed 3-plex microarray (120618_Cele_WS230_JK_CGH), manufactured by Roche NimbleGen Inc. Detailed methods on bioinformatics analysis of the WGS and oaCGH data will be published separately.

Phenotypic analysis of dhc-1

dhc-1(dot168) was separated from other accumulated mutations in the unc-46 mdf-1 such-4 dog-1F470 genome by extensive backcrossing to N2 and using the tetra-primer ARMS-PCR 20 to select for dhc-1(dot168) homozygotes after each backcross. The following primers were designed and used for tetra-primer ARMS-PCR: C allele: AGCAAAGGAAAGATTCTTGATGATAAGTC T allele: TCTTCAGTTTTTCGAGAGTTTCAATAAACA Out_F:CCAGATCTTTATGATCACTCGTGATTC Out_R:AATCTCATTGAGCTGTTGTAGAGTGTGA. Using these primers, homozygous dhc-1(dot168) is recognizable by 2 PCR-bands, 439 bp of the 2 outer primers and 299 bp of the mutant allele N2 homozygotes also produce the 439 bp band, but a 199 bp band for the wild-type allele heterozygotes produce 3 bands (439 bp, 299 bp and 199 bp). First, JNC170 was crossed to N2 and dhc-1(dot168) homozygotes that did not have unc-46(e177) mdf-1(gk2), dog-1(gk10) e such-4(h2168) alleles were selected. Then these dhc-1(dot168) homozygotes were backcrossed to N2 worms an additional 9 times. After each outcross, homozygous dhc-1(dot168) animals were selected. After the final outcross phenotypic analyses and genetic interaction studies were performed.

To assess whether dhc-1(dot168) e dhc-1(or283ts) could suppress the lethality and sterility of mdf-1(gk2), the F1 mdf-1(gk2) homozygotes, segregated from KR3627 (unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)]) strain were mated to either dhc-1(dot168) ou dhc-1(or283ts) males. The phenotypically wild-type l unc-46(e177) mdf-1(gk2)/ + + dhc-1/ + hermaphrodites were allowed to self-fertilize and Unc-46 progeny were plated individually. All of the worms that propagated for more than 3 generations were genotyped and confirmed to be homozygous for dhc-1, while none of the worms that did not be propagated for longer than 3 generations were homozygous for dhc-1.

To construct unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) we mated dhc-1(dot168) males to KR4233 (unc-46(e177) mdf-1(gk2) such-4(h2168)) hermaphrodites and screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, h2168, dot168 homozygotes were kept. The primers and procedure used to track gk2 e h2168 homozygotes were published previously. 9,10 Using the MosSCI method 23 we generated a strain (JNC100) that contains 2 copies of cyb-3 gene. 10 To eliminate the possibility that potential background mutations in KR4233 would interfer with our results, we also constructed unc-46(e177) mdf-1(gk2) dhc-1(dot168) cyb-3 dup (dotSi100). Analysis of this strain revealed similar results to the unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) strain (data not shown). To construct unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) dhc-1(dot168) we mated dhc-1(dot168) males to unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) hermaphrodites then screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, dotSi100, dotSi110, dot168 homozygotes were kept. The primers and procedure used to track dotSi100, dotSi110 homozygotes were published previously. 10,24

Phenotypic analysis of the constructed strains was performed as follows hermaphrodites at L4 stage were grown on fresh OP50 plates at 20⁰C or 25⁰C. The hermaphrodites were transferred to fresh plates every 12 hours. Brood size was calculated based on the total eggs laid by each hermaphrodite. Embryos that did not hatch were scored as embryonic arrests, while the embryos that hatched but did not grow to adult stage were scored as larval arrests. The embryos that developed into adults were analyzed for the presence of males in all the strains analyzed, while all the mdf-1(gk2)-allele containing strains were also analyzed for the percent of the sterile adult progeny by individually plating all the adult progeny and scoring the presence or absence of offspring.

Anaphase onset timing in the early embryo

One-day old gravid adult hermaphrodites were dissected and embryos were mounted onto 3% agarose pads as described previously. 29 Embryos were observed using a Quorum WaveFX Spinning Disk system mounted on Zeiss Axioplan microscope. Early embryonic cell division was recorded using time-lapse video microscopy at 400x, with 200 ms fluorescent exposure, one image every 10 seconds. Image acquisition and analysis was performed using the Volocity software package.

QRT-PCR

qRT-PCR analysis was performed on genomic DNA from wild-type (N2), KR4233, JNC168, JNC169 and JNC170. Three internal references were used, eif-3, cdc-42 and mdh-1 following the procedures described previously. 30 Mean values and standard deviations of relative ratios from four replicates are shown. Each qRT-PCR reaction contained 50 ng of genomic DNA, 10 μL of 2x SYBR Green Supermix (Biorad), and 1 μM of each primer. qRT-PCR reactions were run in quadruplicate on a Biorad MyIQ Real-time thermocycler. Data were normalized using the 3 internal references and the relative fold change was calculated using the ΔΔCt method. All primers were tested on serial dilutions and primer efficiency was calculated.

Table 1. dhc-1 suppresses mdf-1(gk2) lethality and sterility


Conclusões

Molting is a complex developmental process that is carried out in all nematodes, as well as in many other invertebrate species. Molting allows for the replacement of the apical ECM, known as the cuticle, thereby enabling growth or developmental specialization. As described above, a large and diverse collection of genes have been implicated in molting control in C. elegans (Table 1). However, a clear and integrated description of the molting cascade is still missing within nematode species. Further studies will undoubtedly lead to a better understanding of this important developmental process.

Beyond an interest in understanding molting as a developmental process, molting studies may have other significant and practical applications. Notably, molting is a potential focus for antihelminthic drug development, both for human and veterinary medicine. 143-145 Diseases caused by nematodes are still widely distributed in the human population and affect hundreds of millions of people, according to the World Health Organization. 146 Nematode infections can lead to a number of long-term consequences, including death, and can further complicate other diseases. Many of these diseases are zoonoses, meaning that they are naturally transmissible from vertebrate animals to humans. Correspondingly, nematode infections of animals, as well as plants, have significant economic consequences. 147,148 As such, agricultural industries use extensive prophylactic measures to decrease the prevalence of parasitic nematodoses, which cause material damage and financial loss.

Although molting in nematodes might seem to constitute a specialized biological process within invertebrates, understanding the molecular basis for ECM remodeling and other fundamental events associated with molting has broad relevance for biology and our basic knowledge of disease states. Furthermore, because the C. elegans cuticle is largely collagen based, it is potentially useful for understanding dermal physiology and wound healing in higher eukaryotes. 149 In addition, primary tumor invasion through the ECM is an important process during tumor metastasis and shares many conserved features with ECM remodeling. 150-152 Notably, many genes implicated in C. elegans molting have orthologs in higher eukaryotes, indicating that this biological system represents a powerful tool for exploring the functions and molecular mechanisms underlying a wide range of conserved cellular and developmental processes.

Table 1. C. elegans genes implicated in molting that are discussed in this review.


Assista o vídeo: TOP 10 SPY Camera u0026 SPY Gadgets 2020 That Are Next Level. My Deal Buddy (Agosto 2022).